View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6501_low_12 (Length: 381)
Name: NF6501_low_12
Description: NF6501
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6501_low_12 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 235; Significance: 1e-130; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 12 - 270
Target Start/End: Original strand, 43142286 - 43142544
Alignment:
| Q |
12 |
tcatcacatatcttcatccggaatatgttttaacctattaaaaccaatggtactaatgataacatgtcttcatcaatgggctgtgcatggttaaccaaac |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43142286 |
tcatcacatatcttcatccggaatatgttttaacctattaaaaccaatggtactaatgataacatgtcttcatcaatgggctgtgcatggttaaccaaac |
43142385 |
T |
 |
| Q |
112 |
catataacccaatattttttggttaaggttcatataccaaaccattatttggaaaacaccggattatgcttcggaagcggtctgggccggtttagaacag |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||| | |
|
|
| T |
43142386 |
catataacccaatattttttggttaaggttcatataccaaaccattatttggaaaacaccgaattatgcttcggaagcggtttgggccggtttagaaccg |
43142485 |
T |
 |
| Q |
212 |
gttccattatatttgattttcagtcgttaaattcggctgagtgctaccacaaccctctc |
270 |
Q |
| |
|
||||||||||||||||||||||||| |||| ||||| |||||||||||||||||||||| |
|
|
| T |
43142486 |
gttccattatatttgattttcagtcattaatttcggttgagtgctaccacaaccctctc |
43142544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 290 - 381
Target Start/End: Original strand, 43142540 - 43142631
Alignment:
| Q |
290 |
ctctcatttccgttgtccttgtttttgctcttacattctcttatgaaaatacgtggttcataagagaatgtgcgaacattaacaatgatggt |
381 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
43142540 |
ctctcacttccgttgtccttgtttttgctcttacattctcttatgaaaataagtggttcataagagaatgtgtgaacattaacaatgatggt |
43142631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University