View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6501_low_15 (Length: 289)

Name: NF6501_low_15
Description: NF6501
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6501_low_15
NF6501_low_15
[»] chr7 (1 HSPs)
chr7 (47-273)||(37806447-37806673)


Alignment Details
Target: chr7 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 47 - 273
Target Start/End: Complemental strand, 37806673 - 37806447
Alignment:
47 tgattactttgtttaaaaaaggtgannnnnnnccctagaaaaatcaacaaatggactctaaattatccataacatagtattgtttaaacgaacaaaagac 146  Q
    |||||||||||||||||||||||||       ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||    
37806673 tgattactttgtttaaaaaaggtgatttttttccctagaaaaatcaacaaatggactctaaattatccataacatagtattgtttcaacgaacaaaagac 37806574  T
147 aaaagcttggtattgaatatttcatagataaatgtagtggataaataaaaccaacacaatagattaggtagatgaccctcacacacaaaccctttagtag 246  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||    
37806573 aaaagcttggtattgaatatttcatagataaatgtagtggataaataaaaccaacacaatagattaggtagatgagcctcacacacaaaccctttagtag 37806474  T
247 cacaatgaattcaatcaaacatcatag 273  Q
    |||||||||||||||||||||||||||    
37806473 cacaatgaattcaatcaaacatcatag 37806447  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University