View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6501_low_16 (Length: 262)
Name: NF6501_low_16
Description: NF6501
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6501_low_16 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 254; Significance: 1e-141; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 1 - 262
Target Start/End: Complemental strand, 28940376 - 28940115
Alignment:
| Q |
1 |
aggtttgatttattgttggatccttttaaatgtatgtcatatatgtttttcttggtaactgaattttaggtgctaaccaattaacatttattttctacag |
100 |
Q |
| |
|
||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28940376 |
aggttcgatttattgttgtatccttttaaatgtatgtcatatatgtttttcttggtaactgaattttaggtgctaaccaattaacatttattttctacag |
28940277 |
T |
|
| Q |
101 |
ggaaaacatacagacttagaatatcaaatgttggactagaacacacactcaactttaggattcaaggccacatcatgaaattggttgaagttgagggaac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28940276 |
ggaaaacatacagacttagaatatcaaatgttggactagaacacacactcaactttaggattcaaggccacatcatgaaattggttgaagttgagggaac |
28940177 |
T |
|
| Q |
201 |
tcacactgtacaaacgtcttatgactcaatagatgttcatgtcggacaatcttattctgtgc |
262 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28940176 |
tcacactgtacaaacgtcttatgactcaatagatgttcatgtcggacaatcttattctgtgc |
28940115 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University