View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6502_high_10 (Length: 231)
Name: NF6502_high_10
Description: NF6502
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6502_high_10 |
 |  |
|
| [»] chr7 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 108; Significance: 2e-54; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 116 - 231
Target Start/End: Original strand, 44037477 - 44037592
Alignment:
| Q |
116 |
tcacttttgtgcttaccgtgatctttttgcattctttagctaaaagtcactataaactatttcaaatgaggaaaaaatatactaatacaattttataaga |
215 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44037477 |
tcacttttgtgcttaccgtgatctttgtgcattctttagctaaaagtcactataaactttttcaaatgaggaaaaaatatactaatacaattttataaga |
44037576 |
T |
 |
| Q |
216 |
gtaatatgccaacttt |
231 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
44037577 |
gtaatatgccaacttt |
44037592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 4 - 43
Target Start/End: Original strand, 44037366 - 44037405
Alignment:
| Q |
4 |
tcaatatagtgtgatcaacaaataaattatttttttcttt |
43 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44037366 |
tcaatatagtgtgatcaacaaataaattatttttttcttt |
44037405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University