View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6502_low_11 (Length: 259)
Name: NF6502_low_11
Description: NF6502
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6502_low_11 |
 |  |
|
| [»] scaffold0449 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0449 (Bit Score: 115; Significance: 2e-58; HSPs: 1)
Name: scaffold0449
Description:
Target: scaffold0449; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 1 - 135
Target Start/End: Original strand, 9048 - 9182
Alignment:
| Q |
1 |
caagcttcttctctcatggcacggtcagttttcaatcaaaattgattgatctgttgttcgccggcgagaaagaaagcggtttgtttagtttgaagaggcg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||| |||||||||||||| |
|
|
| T |
9048 |
caagcttcttctctcatggcacggtcagttttcaatcaaaattgattgatctgtggttcgccggcgagaaggaaagcggtttgttcagtttgaagaggcg |
9147 |
T |
 |
| Q |
101 |
tgtgttttcttacatttttatgaaaataccgctat |
135 |
Q |
| |
|
|||||||||||||||||||| ||||||||| |||| |
|
|
| T |
9148 |
tgtgttttcttacatttttacgaaaatacccctat |
9182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University