View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6502_low_11 (Length: 259)

Name: NF6502_low_11
Description: NF6502
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6502_low_11
NF6502_low_11
[»] scaffold0449 (1 HSPs)
scaffold0449 (1-135)||(9048-9182)


Alignment Details
Target: scaffold0449 (Bit Score: 115; Significance: 2e-58; HSPs: 1)
Name: scaffold0449
Description:

Target: scaffold0449; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 1 - 135
Target Start/End: Original strand, 9048 - 9182
Alignment:
1 caagcttcttctctcatggcacggtcagttttcaatcaaaattgattgatctgttgttcgccggcgagaaagaaagcggtttgtttagtttgaagaggcg 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||| ||||||||||||||    
9048 caagcttcttctctcatggcacggtcagttttcaatcaaaattgattgatctgtggttcgccggcgagaaggaaagcggtttgttcagtttgaagaggcg 9147  T
101 tgtgttttcttacatttttatgaaaataccgctat 135  Q
    |||||||||||||||||||| ||||||||| ||||    
9148 tgtgttttcttacatttttacgaaaatacccctat 9182  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University