View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6502_low_17 (Length: 236)
Name: NF6502_low_17
Description: NF6502
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6502_low_17 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 1 - 229
Target Start/End: Complemental strand, 16549514 - 16549287
Alignment:
| Q |
1 |
attatcatcaaactttaagccttggagttggttaacttcttggttctttgtgnnnnnnnnnnacttcatccaaggtgatggtgagttctttagcataaag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
16549514 |
attatcatcaaactttaagccttggagttggttaacttcttggttctttgtgttttttttt-acttcatccagggtgatggtgagttctttagcataaag |
16549416 |
T |
|
| Q |
101 |
catggtatccttccttaaagtgctcaaaggatctaggtattgcacacaaaaagtaaagtgttgtcttcatcctgaatgttcaccaaaccattaagaattt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16549415 |
catggtatccttccttaaagtgctcaaaggatctaggtattgcacacaaaaagtaaagtgttgtcttcatcctgaatgttcaccaaaccattaagaattt |
16549316 |
T |
|
| Q |
201 |
tgttaaatttcgtcaattatttgatgatg |
229 |
Q |
| |
|
||||||| ||| |||||| ||| |||||| |
|
|
| T |
16549315 |
tgttaaacttcatcaattgttttatgatg |
16549287 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University