View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6502_low_4 (Length: 502)

Name: NF6502_low_4
Description: NF6502
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6502_low_4
NF6502_low_4
[»] scaffold0449 (1 HSPs)
scaffold0449 (441-494)||(9007-9060)


Alignment Details
Target: scaffold0449 (Bit Score: 54; Significance: 8e-22; HSPs: 1)
Name: scaffold0449
Description:

Target: scaffold0449; HSP #1
Raw Score: 54; E-Value: 8e-22
Query Start/End: Original strand, 441 - 494
Target Start/End: Original strand, 9007 - 9060
Alignment:
441 ttgccaaattctctctcctctgatttttccaccgcgaacggcaagcttcttctc 494  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
9007 ttgccaaattctctctcctctgatttttccaccgcgaacggcaagcttcttctc 9060  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University