View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6503_high_6 (Length: 325)
Name: NF6503_high_6
Description: NF6503
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6503_high_6 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 58; Significance: 2e-24; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 1 - 58
Target Start/End: Complemental strand, 18656130 - 18656073
Alignment:
| Q |
1 |
taaatcgaggtaatttggtggtgttgctttgtagtaaacataggtttgacatggataa |
58 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18656130 |
taaatcgaggtaatttggtggtgttgctttgtagtaaacataggtttgacatggataa |
18656073 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 126 - 190
Target Start/End: Complemental strand, 18656002 - 18655938
Alignment:
| Q |
126 |
atttatggaaagggaagagtaggatgaagatgaaggttgataattggtggtgatggggttggaga |
190 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
18656002 |
atttaaggaaagggaagagtaggatgaagatgaaggttgataattggtggtgatggggtttgaga |
18655938 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 274 - 313
Target Start/End: Complemental strand, 18655848 - 18655809
Alignment:
| Q |
274 |
gggggatgagtcggctttgagatctgactagtcaaggttc |
313 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
18655848 |
gggggatgagtcggctttgagatctgactagtcaatgttc |
18655809 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University