View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6503_high_7 (Length: 251)
Name: NF6503_high_7
Description: NF6503
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6503_high_7 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 77 - 237
Target Start/End: Complemental strand, 7134887 - 7134725
Alignment:
| Q |
77 |
atacaaggtgaaaaaactcatggaattggacgcaaacgtaacatgattataaatctagaggtaatctccctcgacatacatctcgtcggctaaaattctc |
176 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7134887 |
atacaaggtgaaaaaactcatggaattggacgcaaacgtaacatgattataaatctagaggtaatctccctcgacatacatctcgtcggctaaaattctc |
7134788 |
T |
 |
| Q |
177 |
ttatggatacaatctattctcgacacttgctatccgatatgaata--aatctaatgaatgttt |
237 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||| |
|
|
| T |
7134787 |
ttatggatacaatctattctcgacacttactatccgatatgaataagaatctaatgaatgttt |
7134725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University