View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6503_low_14 (Length: 226)

Name: NF6503_low_14
Description: NF6503
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6503_low_14
NF6503_low_14
[»] chr8 (1 HSPs)
chr8 (79-207)||(38848115-38848240)


Alignment Details
Target: chr8 (Bit Score: 91; Significance: 3e-44; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 79 - 207
Target Start/End: Complemental strand, 38848240 - 38848115
Alignment:
79 gaataagggacgtaatacttgttcataatccattgaaggatttgaacctgaacttgtcgctttgcatgagtaccnnnnnnngacaaaagtacgttgcaag 178  Q
    |||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||       |||||||||||||||||||    
38848240 gaataagggacgtaatacttgttcataatcaattgaaggctttgaacctgaacttgtcgctttgcatgagtacc---aaaagacaaaagtacgttgcaag 38848144  T
179 ctaaggaaaaaacaatagacatttttctc 207  Q
    |||||||||||||||||||| ||||||||    
38848143 ctaaggaaaaaacaatagacctttttctc 38848115  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University