View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6503_low_8 (Length: 325)

Name: NF6503_low_8
Description: NF6503
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6503_low_8
NF6503_low_8
[»] chr5 (3 HSPs)
chr5 (1-58)||(18656073-18656130)
chr5 (126-190)||(18655938-18656002)
chr5 (274-313)||(18655809-18655848)


Alignment Details
Target: chr5 (Bit Score: 58; Significance: 2e-24; HSPs: 3)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 1 - 58
Target Start/End: Complemental strand, 18656130 - 18656073
Alignment:
1 taaatcgaggtaatttggtggtgttgctttgtagtaaacataggtttgacatggataa 58  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
18656130 taaatcgaggtaatttggtggtgttgctttgtagtaaacataggtttgacatggataa 18656073  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 126 - 190
Target Start/End: Complemental strand, 18656002 - 18655938
Alignment:
126 atttatggaaagggaagagtaggatgaagatgaaggttgataattggtggtgatggggttggaga 190  Q
    ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
18656002 atttaaggaaagggaagagtaggatgaagatgaaggttgataattggtggtgatggggtttgaga 18655938  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 274 - 313
Target Start/End: Complemental strand, 18655848 - 18655809
Alignment:
274 gggggatgagtcggctttgagatctgactagtcaaggttc 313  Q
    ||||||||||||||||||||||||||||||||||| ||||    
18655848 gggggatgagtcggctttgagatctgactagtcaatgttc 18655809  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University