View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6505_low_3 (Length: 318)
Name: NF6505_low_3
Description: NF6505
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6505_low_3 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 140; Significance: 2e-73; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 141 - 292
Target Start/End: Original strand, 27444395 - 27444546
Alignment:
| Q |
141 |
aaacccatgcaactaccattaagcaggcgaccccaaaaacaataccagaaattatgccaaaaaatcttgcaaccggaaatttgttcttctgaggtggtgg |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27444395 |
aaacccatgcaactaccattaagcaggcgaccccaaaaacaataccagaaattatgccaaaaaatcttgcaaccggaaatttgttcttctgaggtggtgg |
27444494 |
T |
 |
| Q |
241 |
agggttgattattacttcatttggtggagctactggttctggtggtggtgga |
292 |
Q |
| |
|
| |||||||||||||||||| || |||||||||||||||||||||||||||| |
|
|
| T |
27444495 |
acggttgattattacttcatctgatggagctactggttctggtggtggtgga |
27444546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 18 - 141
Target Start/End: Original strand, 27444237 - 27444360
Alignment:
| Q |
18 |
aattgaaacggccatattaggagcagcttcgacattattttgaatactactcgatggaacactttcatctctataatgacaaggatgtgaaactatttca |
117 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27444237 |
aattgaaacggccatattagtagcagcttcgacattattttgaatactactcgatggaacattttcatctctataatgacaaggatgtgaaactatttca |
27444336 |
T |
 |
| Q |
118 |
ttgagacagtgaacatccgcttga |
141 |
Q |
| |
|
||||||| |||||||||||||||| |
|
|
| T |
27444337 |
ttgagactgtgaacatccgcttga |
27444360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 215 - 243
Target Start/End: Original strand, 27444601 - 27444629
Alignment:
| Q |
215 |
ggaaatttgttcttctgaggtggtggagg |
243 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
27444601 |
ggaaatttgttcttctgaggtggtggagg |
27444629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University