View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6506_high_7 (Length: 251)
Name: NF6506_high_7
Description: NF6506
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6506_high_7 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 119; Significance: 7e-61; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 119; E-Value: 7e-61
Query Start/End: Original strand, 83 - 231
Target Start/End: Complemental strand, 27921946 - 27921799
Alignment:
| Q |
83 |
agttatttctgttaatatttttccgatgttaaactctaaaactgaacttttaatttataaagtgttcgacaaagacnnnnnnnatctaagggatttgaaa |
182 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
27921946 |
agttatttctgttaatatttttccgatgttaaactctaaaactgaacttttaatttataaagtgtttgacaaagac-ttttttatctaagggatttgaaa |
27921848 |
T |
 |
| Q |
183 |
taatttcatcagtagatctagttgctagacatatagctagatttgcact |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27921847 |
taatttcatcagtagatctagttgctagacatatagctagatttgcact |
27921799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 10 - 63
Target Start/End: Complemental strand, 27922153 - 27922100
Alignment:
| Q |
10 |
gagcacagagtagtcgataagtatcaaattggtggaagcattcaagacttggat |
63 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27922153 |
gagcacaaagtagtcgataagtatcaaattggtggaagcattcaagacttggat |
27922100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University