View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6507_high_18 (Length: 335)
Name: NF6507_high_18
Description: NF6507
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6507_high_18 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 299; Significance: 1e-168; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 299; E-Value: 1e-168
Query Start/End: Original strand, 1 - 324
Target Start/End: Complemental strand, 34439450 - 34439125
Alignment:
| Q |
1 |
atgagatgcttgaaaaatactgtggtgagtttggaaaatggcagctgaaacacttcattctcacatat--tgcttgggctttggaagcttttcatactat |
98 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||| |||||||||||||||||||| |
|
|
| T |
34439450 |
atgagatgcttgagaaatactgtggtgagtttggaaaatggcagctgaaacacttcattctcacatgtcttgcttgggcgttggaagcttttcatactat |
34439351 |
T |
|
| Q |
99 |
ggttatgatttttgctgatagggaacctgattggaagtgtgttgaaggtatggagtgttcagccgatggaagtgtctgcgatatggcgtcgtcgtcgtgg |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34439350 |
ggttatgatttttgctgatagggaacctgattggaagtgtgttgaaggtatggagtgttccgccgatggaagtgtctgcgatatggcgtcgtcgtcgtgg |
34439251 |
T |
|
| Q |
199 |
gagtggatcggagggaaagatgcttctacggtgactgagtggagtttgatatgtggtgacaagtttaaagttggacttgttcaagctgttttctttactg |
298 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34439250 |
gagtggatcggagggaaagatgcttctacggtgactgagtggagtttgatatgtggtgacaagtttaaagttggacttgttcaagctgttttctttactg |
34439151 |
T |
|
| Q |
299 |
gttgtatgattggttcgttcattctt |
324 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
34439150 |
gttgtatgattggttcgttcattctt |
34439125 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 1 - 319
Target Start/End: Complemental strand, 34422592 - 34422272
Alignment:
| Q |
1 |
atgagatgcttgaaaaatactgtggtgagtttggaaaatggcagctgaaacacttcattctcaca--tattgcttgggctttggaagcttttcatactat |
98 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||| |||||||||||||||||||| |
|
|
| T |
34422592 |
atgagatgcttgagaaatactgtggtgagtttggaaaatggcagctgaaacacttcattctcacaagtcttgcttgggcgttggaagcttttcatactat |
34422493 |
T |
|
| Q |
99 |
ggttatgatttttgctgatagggaacctgattggaagtgtgttgaaggtatggagtgttcagccgatggaagtgtctgcgatatggcgtcgtcgtcgtgg |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||| |||||||||||| |
|
|
| T |
34422492 |
ggttatgatttttgctgatagggaacctgattggaagtgtgttgaaggtatggagtgttccgccaatggaagtgtctgcgatatggcatcgtcgtcgtgg |
34422393 |
T |
|
| Q |
199 |
gagtggatcggagggaaagatgcttctacggtgactgagtggagtttgatatgtggtgacaagtttaaagttggacttgttcaagctgttttctttactg |
298 |
Q |
| |
|
||||| | | || ||| ||||||||||||| |||| ||||||||||| |||||||| |||||||| ||||||||||||||||| |||||||| ||| |
|
|
| T |
34422392 |
cagtgggttgctggtgaaggtgcttctacggtgtctgaatggagtttgatttgtggtgataagtttaagattggacttgttcaagctcttttctttgctg |
34422293 |
T |
|
| Q |
299 |
gttgtatgattggttcgttca |
319 |
Q |
| |
|
| ||||||||||||| ||||| |
|
|
| T |
34422292 |
ggtgtatgattggttagttca |
34422272 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University