View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6507_low_28 (Length: 254)
Name: NF6507_low_28
Description: NF6507
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6507_low_28 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 156; Significance: 6e-83; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 156; E-Value: 6e-83
Query Start/End: Original strand, 1 - 244
Target Start/End: Complemental strand, 38419303 - 38419073
Alignment:
| Q |
1 |
caataacatcttttccctcttaatcaattttctctctttcactagtttttagagattgtgttgaaaagtgtatgctgaaatgtttattgctggcatttct |
100 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||| |||||||||||||| |
|
|
| T |
38419303 |
caataacatcttttcc-tcttaatcaattttctctctttcactagtttttagagattgtgttgaaaaatgtatggtgaaatgtttgttgctggcatttct |
38419205 |
T |
 |
| Q |
101 |
cttctcataatttcacttgagattcatcacaaattagaagctgatccatnnnnnnnnnnnnnnnnngtaaataaccccagtcatctatactattgctagt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
38419204 |
cttctcataatttcacttgagattcatcacaaattagaagctgatccat------------aaaaagtaaataaccccagccatctatactattgctagt |
38419117 |
T |
 |
| Q |
201 |
tgaattttctttggtgaacttctaataaacaataattttcttgg |
244 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
38419116 |
tgaattttctttggtgaacttctaataagcaataatttttttgg |
38419073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University