View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6507_low_32 (Length: 246)
Name: NF6507_low_32
Description: NF6507
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6507_low_32 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 168; Significance: 4e-90; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 1 - 235
Target Start/End: Complemental strand, 4872634 - 4872418
Alignment:
| Q |
1 |
tagattagatagattacgatatatagtagaaccaaagctgatattcttagcagtcatttcagaataaaaatcataggcttgatgtacgtacaagtctatc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4872634 |
tagattagatagattacgatatatagtagaaccacagctgatattcttagcagtcatttcagaataaaaatcataggcttgatgtacgtacaagtctatc |
4872535 |
T |
 |
| Q |
101 |
tttgcacagcctgcatattatgtacctgtagaacatattcgtgaaggctgttaagatccatctctatctttctgaacaagtggatggctcttttagtttc |
200 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
4872534 |
tttgcacagcctgcgtattatgtacctgtagaacatattcgtgaaggctgttaagatc------------------caagtggatggctcttttagtttc |
4872453 |
T |
 |
| Q |
201 |
acctatctcacataagctaccgactagatgatgat |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
4872452 |
acctatctcacataagctaccgactagatgatgat |
4872418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 54 - 106
Target Start/End: Complemental strand, 677263 - 677215
Alignment:
| Q |
54 |
tcatttcagaataaaaatcataggcttgatgtacgtacaagtctatctttgca |
106 |
Q |
| |
|
||||||||||||| |||||||||||||||| ||||||||||||||||||| |
|
|
| T |
677263 |
tcatttcagaatataaatcataggcttgat----gtacaagtctatctttgca |
677215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University