View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6507_low_33 (Length: 244)
Name: NF6507_low_33
Description: NF6507
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6507_low_33 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 19 - 244
Target Start/End: Complemental strand, 8810427 - 8810202
Alignment:
| Q |
19 |
ttcctaatgtgaattcagctaatgttgccggtggtgaggctgttgcgccgttgcaagcaatttctccagagccgcaatctgcagttgagcaagttccgtg |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8810427 |
ttcctaatgtgaattcagctaatgttgccggcggtgaggctgttgcaccgttgcaagcaatttctccagagccgcaatctgcagttgagcaagttccgtg |
8810328 |
T |
|
| Q |
119 |
gccggagtcatcgaattggcagccggttcttccccagaatctacctgaccatccggttggtgcttggaaggttctggaagttccttttgcgagctcgaaa |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8810327 |
gccggagtcatcgaattggcagccggttcttccccagaatctacctgaccatccggttggtgcttggaaggttctggaagttccttttgcgagctcgaaa |
8810228 |
T |
|
| Q |
219 |
ccagtagttccaagttccggtcttcc |
244 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
8810227 |
ccagtagttccaagttccggtcttcc |
8810202 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 50; Significance: 1e-19; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 102 - 191
Target Start/End: Original strand, 31936060 - 31936149
Alignment:
| Q |
102 |
gttgagcaagttccgtggccggagtcatcgaattggcagccggttcttccccagaatctacctgaccatccggttggtgcttggaaggtt |
191 |
Q |
| |
|
||||||||||||||||| || || || ||||||| ||| ||||||||| ||||||||||||||||||| |||| | |||||||||||||| |
|
|
| T |
31936060 |
gttgagcaagttccgtgaccagaatcgtcgaatttgcaaccggttcttgcccagaatctacctgaccaaccggctagtgcttggaaggtt |
31936149 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University