View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6507_low_34 (Length: 243)
Name: NF6507_low_34
Description: NF6507
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6507_low_34 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 18 - 232
Target Start/End: Original strand, 38502680 - 38502894
Alignment:
| Q |
18 |
atacgtaccatgggaggaatggtatattgcatcatttacaacaaggtccctcggattatcaaatgatatatatcttttaaaaatggcaatgccttttctt |
117 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38502680 |
atacgtaccatgggaggaatagtatattgcatcatttacaacaaggtccctcggattatcaaatgatatatatcttttaaaaatggcaatgccttttctt |
38502779 |
T |
|
| Q |
118 |
ttatggtttgagccctaattaaactggataaagggtatggtggcaaacatacatcatttctttttgtcttgcttgtaggatcccattatgacatttcaaa |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38502780 |
ttatggtttgagccctaattaaactggataaagggcatggtggcaaacatacatcatttctttttgtcttgcttgtaggatcccattatgacatttcaaa |
38502879 |
T |
|
| Q |
218 |
ttaattaccacctat |
232 |
Q |
| |
|
|||||||||| |||| |
|
|
| T |
38502880 |
ttaattaccaactat |
38502894 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University