View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6507_low_44 (Length: 202)

Name: NF6507_low_44
Description: NF6507
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6507_low_44
NF6507_low_44
[»] chr5 (1 HSPs)
chr5 (103-184)||(33206349-33206430)


Alignment Details
Target: chr5 (Bit Score: 70; Significance: 9e-32; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 70; E-Value: 9e-32
Query Start/End: Original strand, 103 - 184
Target Start/End: Original strand, 33206349 - 33206430
Alignment:
103 gaaagtacacaaggttatcgacaaggtgccaccctctactttcaacctcaacagaacattgctccagtacggccaaccttct 184  Q
    ||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||    
33206349 gaaagtacacaaggttatcaacaaggtgccaccctctactttcaacctcaacggaacattgctccggtacggccaaccttct 33206430  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University