View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6509_low_10 (Length: 250)
Name: NF6509_low_10
Description: NF6509
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6509_low_10 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 10 - 238
Target Start/End: Complemental strand, 38942581 - 38942348
Alignment:
| Q |
10 |
gttgcagaggagtctcatgtcgagcctatttgtccacaccagatttgttttgcttaaatatcattcactttcacgatttttgtcctgaacaaaggtatag |
109 |
Q |
| |
|
||||||||||||| |||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||| | |
|
|
| T |
38942581 |
gttgcagaggagtttcatgttgagcctatttgtccacaccagatttgttttgcttaataatcattcactttcacgattgttgtcctgaacaaaggtatgg |
38942482 |
T |
 |
| Q |
110 |
gcaatgagaaacaaacaactgcattcatactacattcttatgagtaaagccacaattgatgttcaataatgagaaacatgtttagttgacaatgcaggac |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||| |||||||||||||||||||||||||| ||| |
|
|
| T |
38942481 |
gcaatgagaaacaaacaactgcattcatactacattcttatgagtatagccacaattgatattcaataaagagaaacatgtttagttgacaatgcaagac |
38942382 |
T |
 |
| Q |
210 |
atctat-----aatattatgcttttggttatttt |
238 |
Q |
| |
|
|||||| |||||||||||||||||||||| |
|
|
| T |
38942381 |
atctattggacgatattatgcttttggttatttt |
38942348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 10 - 66
Target Start/End: Complemental strand, 21990170 - 21990114
Alignment:
| Q |
10 |
gttgcagaggagtctcatgtcgagcctatttgtccacaccagatttgttttgcttaa |
66 |
Q |
| |
|
|||||||||||| ||||||| | ||||||||||| || ||| |||||||||||||| |
|
|
| T |
21990170 |
gttgcagaggagcttcatgtcaaacctatttgtccgcatcaggtttgttttgcttaa |
21990114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University