View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6509_low_9 (Length: 265)
Name: NF6509_low_9
Description: NF6509
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6509_low_9 |
 | |
|
| [»] chr1 (2 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 231; Significance: 1e-127; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 11 - 265
Target Start/End: Original strand, 36525113 - 36525367
Alignment:
| Q |
11 |
aaaatacccggaaaaatattcttcaaatgtcccttggaatccccatctgaatgctgcacaactgatattctggacaatgtgccaacactgtaaaggcagg |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36525113 |
aaaatacccggaaaaatattcttcaaatgtcccttggaatccccatctgaatgctgcacaactgatattctggacaatgtgccaacactgtaaaggcagg |
36525212 |
T |
|
| Q |
111 |
ttccagtaccccttaagtattatgaatatggtcataccctgtcacaatttcaagaaaagctttaaagctcaagctattagtattagtgatcaacagcctg |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
36525213 |
ttccagtaccccttaagtattatgaatatggtcataccctgtcacaattgtaagaaaaactttaaagctcaagctattggtattagtgatcaacagcctg |
36525312 |
T |
|
| Q |
211 |
ccccttcatctgtaccgtttggtgccccaaaaaaggctcgaatgcaggctccgcc |
265 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
36525313 |
ccccttcatctgtaccctttggtgccccgaaaaaggctcgaatgcaggctccgcc |
36525367 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 43 - 119
Target Start/End: Complemental strand, 26305901 - 26305825
Alignment:
| Q |
43 |
cttggaatccccatctgaatgctgcacaactgatattctggacaatgtgccaacactgtaaaggcaggttccagtac |
119 |
Q |
| |
|
|||||||||||||||| || |||||| ||| || |||||||||| | |||||||| ||||| |||||||||||||| |
|
|
| T |
26305901 |
cttggaatccccatctcaaagctgcaaaacagacattctggacagtttgccaacattgtaatagcaggttccagtac |
26305825 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University