View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6510_high_16 (Length: 344)
Name: NF6510_high_16
Description: NF6510
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6510_high_16 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 117; Significance: 1e-59; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 1 - 117
Target Start/End: Complemental strand, 44493338 - 44493222
Alignment:
| Q |
1 |
ttaaatgctttattagtttatttgaactctctctatatggaaggttaagcatacttgtatcatttcgttctatatatctacactgactaatctagtagta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44493338 |
ttaaatgctttattagtttatttgaactctctctatatggaaggttaagcatacttgtatcatttcgttctatatatctacactgactaatctagtagta |
44493239 |
T |
|
| Q |
101 |
gcagccctttcctataa |
117 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
44493238 |
gcagccctttcctataa |
44493222 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 74; E-Value: 7e-34
Query Start/End: Original strand, 246 - 339
Target Start/End: Complemental strand, 44492673 - 44492580
Alignment:
| Q |
246 |
ggatccccctgaactactcagtgtacgtgtctaattcaactatacaaaatcggtttataaaaactatgtacttataaacaaatgttcatctcac |
339 |
Q |
| |
|
|||||||||||||||||||| ||||||||| ||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||| |||| |
|
|
| T |
44492673 |
ggatccccctgaactactcaatgtacgtgtttaattcaactatacaaaatcgatttataaaaactatctacttataaacaaatgttcatatcac |
44492580 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 115 - 178
Target Start/End: Complemental strand, 44492811 - 44492741
Alignment:
| Q |
115 |
taacaaagcaacttagaggttggggaaccc-------aagtaaccaaatttagattcaatttttcatgtta |
178 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
44492811 |
taacaaagcaacttagaggttggggaacccaagtcccaagtaaccaaatttagatttaatttttcatgtta |
44492741 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University