View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6510_high_19 (Length: 330)
Name: NF6510_high_19
Description: NF6510
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6510_high_19 |
 |  |
|
| [»] scaffold0722 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0722 (Bit Score: 279; Significance: 1e-156; HSPs: 1)
Name: scaffold0722
Description:
Target: scaffold0722; HSP #1
Raw Score: 279; E-Value: 1e-156
Query Start/End: Original strand, 1 - 311
Target Start/End: Original strand, 5839 - 6154
Alignment:
| Q |
1 |
gtactacattttatggtgaataaaagtgatggggtcccggttctttaatttggtgttcagatggcttgagagatgaaaaaga-gcatatgatgtaatgct |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||| |
|
|
| T |
5839 |
gtactacattttatggtgaataaaagtgatggggtcccggttctttaatttggtgttcagatggctagagagatgaaaaagaagcatatgatgtaatgct |
5938 |
T |
 |
| Q |
100 |
aatttaaagttgttcagatcagcatgcaataaattcctcaatctcaaaccacagtttcacaacacctcgtgcttctac----caactcttccagaaactg |
195 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
5939 |
aagttaaagttgttcagatcagcatgcaataaattcctcaatctcaaaccacagtttcacaacacctcgtgcttctacttttcaactcttccagaaactg |
6038 |
T |
 |
| Q |
196 |
cttcaaacaccatcacaagatttgggcattgtagtaaacatcaatctcaacaagccacttgctaatgtgtctatttccctattgattgtctccgccgtgt |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
6039 |
cttcaaacaccatcacaagatttgggcattgtagtaaacatcaatctcaacaagccacttgcttatgtgtctatttccctattgattgtctccgccgtgt |
6138 |
T |
 |
| Q |
296 |
ataatcatatttgatg |
311 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
6139 |
ataatcatatttgatg |
6154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University