View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6510_high_40 (Length: 235)
Name: NF6510_high_40
Description: NF6510
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6510_high_40 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 154; Significance: 8e-82; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 154; E-Value: 8e-82
Query Start/End: Original strand, 20 - 220
Target Start/End: Complemental strand, 43486665 - 43486475
Alignment:
| Q |
20 |
cattagagaaggtaaatgcattgctggctgcacaatatgacaattatatggcttggtggacgttcaatttcaaacatttcaaccaagtaaagcactcctt |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43486665 |
cattagagaaggtaaatgcattgctggctgcacaatatgaaaattatatggcttggtggatgttcaatttcaaacatttcaaccaagtaaagcactcctt |
43486566 |
T |
|
| Q |
120 |
ttgtcgttcttcaaaagcataggcttcccccaaaatataacaaaatattataaagacataaagtaatacaaaatatgtatgcacccaccacgggttattc |
219 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43486565 |
ttgtcgtttttcaaaagcataggcttcccccaaa----------atattataaagacataaagtaatacaaaatatgtatgcacccaccacgggttattc |
43486476 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University