View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6510_low_26 (Length: 298)

Name: NF6510_low_26
Description: NF6510
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6510_low_26
NF6510_low_26
[»] chr1 (1 HSPs)
chr1 (58-298)||(3015624-3015864)


Alignment Details
Target: chr1 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 58 - 298
Target Start/End: Original strand, 3015624 - 3015864
Alignment:
58 atcaaatatggatgattttgcatgttgttgttggcttgatttttgccctagttgcatggattctgagtttctttaaaatatttgagtttttactttttac 157  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |    
3015624 atcaaatatggatgattttgcatgttgttgttggcttgatttttgccctagttgcatggattctgagtttctttaaaatatttgagtttttactttttgc 3015723  T
158 aattggtttgcatgtttgttatcgcatcgagtttatcaaaatcacggtgagctaccataattttgtaaaagtcacaggttgtggcttttgaaactcatgt 257  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||    
3015724 aattggtttgcatgtttgttatcgcatcgagtttatcaaaatcacggtgagctaccataattttgtaaaagtcacatgttgtggcttttgaaaatcatgt 3015823  T
258 tgtctcaccgcgcttaatggggtgagtcttgccaaaaattg 298  Q
    |||||||||||| ||||||||||||||||||||||||||||    
3015824 tgtctcaccgcgattaatggggtgagtcttgccaaaaattg 3015864  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University