View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6510_low_26 (Length: 298)
Name: NF6510_low_26
Description: NF6510
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6510_low_26 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 58 - 298
Target Start/End: Original strand, 3015624 - 3015864
Alignment:
| Q |
58 |
atcaaatatggatgattttgcatgttgttgttggcttgatttttgccctagttgcatggattctgagtttctttaaaatatttgagtttttactttttac |
157 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
3015624 |
atcaaatatggatgattttgcatgttgttgttggcttgatttttgccctagttgcatggattctgagtttctttaaaatatttgagtttttactttttgc |
3015723 |
T |
 |
| Q |
158 |
aattggtttgcatgtttgttatcgcatcgagtttatcaaaatcacggtgagctaccataattttgtaaaagtcacaggttgtggcttttgaaactcatgt |
257 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||| |
|
|
| T |
3015724 |
aattggtttgcatgtttgttatcgcatcgagtttatcaaaatcacggtgagctaccataattttgtaaaagtcacatgttgtggcttttgaaaatcatgt |
3015823 |
T |
 |
| Q |
258 |
tgtctcaccgcgcttaatggggtgagtcttgccaaaaattg |
298 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
3015824 |
tgtctcaccgcgattaatggggtgagtcttgccaaaaattg |
3015864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University