View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6510_low_39 (Length: 245)
Name: NF6510_low_39
Description: NF6510
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6510_low_39 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 221; Significance: 1e-122; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 1 - 233
Target Start/End: Original strand, 46929073 - 46929305
Alignment:
| Q |
1 |
gtagagcctgaggaacggtccacccctggatttgatgttcttgttcatgatgaatctgggaacaacctgggttatgagggcggttctgaatatttgccag |
100 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46929073 |
gtagagcctgaggaacggtcctcccctggatttgatgttcttgttcatgatgaatctgggaacaacctgggttatgagggcggttctgaatatttgccag |
46929172 |
T |
 |
| Q |
101 |
tgcttgatatggatgaccatgaactgaatgagcaatacttgggttatgaatttaaaaacacaaatgattacgaaaccatgtgctcaggcgctgatattct |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
46929173 |
tgcttgatatggatgaccatgaactgaatgagcaatacttgggttatgaatttaaaaacacaaatgattacgacaccatgtgctcaggcgctgatattct |
46929272 |
T |
 |
| Q |
201 |
ttatgaacggaaaacatatgatgattactgatg |
233 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| |
|
|
| T |
46929273 |
ttatgaacggaaaacatatgatgattacagatg |
46929305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 23 - 228
Target Start/End: Original strand, 47166300 - 47166505
Alignment:
| Q |
23 |
cccctggatttgatgttcttgttcatgatgaatctgggaacaacctgggttatgagggcggttctgaatatttgccagtgcttgatatggatgaccatga |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47166300 |
cccctggatttgatgttcttgttcatgatgaatctgggaacaacctgggttatgagggcggttctgaatatttgccagtgcttgatatggatgaccatga |
47166399 |
T |
 |
| Q |
123 |
actgaatgagcaatacttgggttatgaatttaaaaacacaaatgattacgaaaccatgtgctcaggcgctgatattctttatgaacggaaaacatatgat |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47166400 |
actgaatgagcaatacttgggttatgaatttaaaaacacaaatgattacgacaccatgtgctcaggcgctgatattctttatgaacggaaaacatatgat |
47166499 |
T |
 |
| Q |
223 |
gattac |
228 |
Q |
| |
|
|||||| |
|
|
| T |
47166500 |
gattac |
47166505 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University