View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6510_low_44 (Length: 237)

Name: NF6510_low_44
Description: NF6510
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6510_low_44
NF6510_low_44
[»] chr8 (2 HSPs)
chr8 (1-222)||(35983797-35984018)
chr8 (102-190)||(31903708-31903796)
[»] chr6 (6 HSPs)
chr6 (127-190)||(28491762-28491825)
chr6 (127-190)||(29804172-29804235)
chr6 (108-190)||(28226813-28226895)
chr6 (134-183)||(28481344-28481393)
chr6 (134-183)||(29793767-29793816)
chr6 (122-190)||(28234441-28234509)
[»] scaffold0038 (2 HSPs)
scaffold0038 (108-190)||(27311-27393)
scaffold0038 (122-190)||(34602-34670)
[»] scaffold0019 (1 HSPs)
scaffold0019 (122-190)||(58524-58592)


Alignment Details
Target: chr8 (Bit Score: 214; Significance: 1e-117; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 35983797 - 35984018
Alignment:
1 tcaccatatttcaactatttctattctttgactttggaattggaaaccaaaaactccatttccactttgttctgaccttaatctgctaatggctgtgtct 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35983797 tcaccatatttcaactatttctattctttgactttggaattggaaaccaaaaactccatttccactttgttctgaccttaatctgctaatggctgtgtct 35983896  T
101 acatcctcttcatccttcagttatggattcacctacgatgttttccttagctttcgaggtctagacactcgctatggtttcaccggaaataaattcactt 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||    
35983897 acatcctcttcatccttcagttatggattcacctacgatgttttccttagctttcaaggtctagacactagctatggtttcaccggaaataaattcactt 35983996  T
201 cttgatgttgggtcgaatgatg 222  Q
    ||||||||||||||||||||||    
35983997 cttgatgttgggtcgaatgatg 35984018  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 102 - 190
Target Start/End: Original strand, 31903708 - 31903796
Alignment:
102 catcctcttcatccttcagttatggattcacctacgatgttttccttagctttcgaggtctagacactcgctatggtttcaccggaaat 190  Q
    |||| ||||| | ||||||||||||||||||||||||||| ||||| |||||| ||||  ||||||||||||||||||| || ||||||    
31903708 catcttcttctttcttcagttatggattcacctacgatgtgttcctcagctttagaggcttagacactcgctatggttttactggaaat 31903796  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 32; Significance: 0.000000005; HSPs: 6)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 127 - 190
Target Start/End: Complemental strand, 28491825 - 28491762
Alignment:
127 attcacctacgatgttttccttagctttcgaggtctagacactcgctatggtttcaccggaaat 190  Q
    ||||||||| ||||| ||||||||||||||||||   || |||||||| |||||||| ||||||    
28491825 attcacctatgatgtgttccttagctttcgaggtgaggatactcgctacggtttcactggaaat 28491762  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 127 - 190
Target Start/End: Complemental strand, 29804235 - 29804172
Alignment:
127 attcacctacgatgttttccttagctttcgaggtctagacactcgctatggtttcaccggaaat 190  Q
    ||||||||| ||||| ||||||||||||||||||   || |||||||| |||||||| ||||||    
29804235 attcacctatgatgtgttccttagctttcgaggtgaggatactcgctacggtttcactggaaat 29804172  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 108 - 190
Target Start/End: Original strand, 28226813 - 28226895
Alignment:
108 cttcatccttcagttatggattcacctacgatgttttccttagctttcgaggtctagacactcgctatggtttcaccggaaat 190  Q
    |||| ||||||  ||||||||||||||| || || |||||||| ||| ||||| | |||||||| |||||||| || ||||||    
28226813 cttcttccttctcttatggattcacctatgacgtgttccttagttttagaggtattgacactcgttatggttttactggaaat 28226895  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 134 - 183
Target Start/End: Complemental strand, 28481393 - 28481344
Alignment:
134 tacgatgttttccttagctttcgaggtctagacactcgctatggtttcac 183  Q
    |||||||||||||| ||||||||||||   || |||||||||||||||||    
28481393 tacgatgttttcctcagctttcgaggtgaggatactcgctatggtttcac 28481344  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 134 - 183
Target Start/End: Complemental strand, 29793816 - 29793767
Alignment:
134 tacgatgttttccttagctttcgaggtctagacactcgctatggtttcac 183  Q
    |||||||||||||| ||||||||||||   || |||||||||||||||||    
29793816 tacgatgttttcctcagctttcgaggtgaggatactcgctatggtttcac 29793767  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 122 - 190
Target Start/End: Original strand, 28234441 - 28234509
Alignment:
122 tatggattcacctacgatgttttccttagctttcgaggtctagacactcgctatggtttcaccggaaat 190  Q
    |||||||||||||| || || |||||||| ||| |||||   ||||||||||||||||| |||| ||||    
28234441 tatggattcacctatgacgtgttccttagttttagaggtagtgacactcgctatggttttaccgaaaat 28234509  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0038 (Bit Score: 31; Significance: 0.00000002; HSPs: 2)
Name: scaffold0038
Description:

Target: scaffold0038; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 108 - 190
Target Start/End: Original strand, 27311 - 27393
Alignment:
108 cttcatccttcagttatggattcacctacgatgttttccttagctttcgaggtctagacactcgctatggtttcaccggaaat 190  Q
    |||| ||||||  ||||||||||||||| || || |||||||| ||| ||||| | |||||||| |||||||| || ||||||    
27311 cttcttccttctcttatggattcacctatgacgtgttccttagttttagaggtattgacactcgttatggttttactggaaat 27393  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0038; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 122 - 190
Target Start/End: Original strand, 34602 - 34670
Alignment:
122 tatggattcacctacgatgttttccttagctttcgaggtctagacactcgctatggtttcaccggaaat 190  Q
    |||||||||||||| || || |||||||| ||| |||||   ||||||||||||||||| |||| ||||    
34602 tatggattcacctatgacgtgttccttagttttagaggtagtgacactcgctatggttttaccgaaaat 34670  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0019 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0019
Description:

Target: scaffold0019; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 122 - 190
Target Start/End: Complemental strand, 58592 - 58524
Alignment:
122 tatggattcacctacgatgttttccttagctttcgaggtctagacactcgctatggtttcaccggaaat 190  Q
    ||||||||||||||  | || |||||||||||| |||||   ||||||||||||||||| || ||||||    
58592 tatggattcacctatcacgtgttccttagctttagaggttgtgacactcgctatggttttactggaaat 58524  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University