View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6510_low_49 (Length: 228)
Name: NF6510_low_49
Description: NF6510
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6510_low_49 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 106; Significance: 3e-53; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 106; E-Value: 3e-53
Query Start/End: Original strand, 1 - 132
Target Start/End: Original strand, 5832346 - 5832473
Alignment:
| Q |
1 |
tgaataaacattgctctaaatgtaaggaaaggtgagcaatgattatttttgtgagaattaaaaagaaccaaacttccttgcatagaagaattaaagaaac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
5832346 |
tgaataaacattgctctaaatgtaaggaaaggtgagca-tgattatttttgtgagaattaaaaagaacaaaacttccttgcatagaagaattaaagaaac |
5832444 |
T |
|
| Q |
101 |
tttagaataaataaatatatgtcacgctttag |
132 |
Q |
| |
|
||||||||| |||||||||||||||||||| |
|
|
| T |
5832445 |
tttagaata---aaatatatgtcacgctttag |
5832473 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 142 - 228
Target Start/End: Original strand, 5832458 - 5832545
Alignment:
| Q |
142 |
atatgtcacactttagtctccaaaattgtagatattggacaatttggtctcttaaactaattaaaatactaaaa-atcactaaaatat |
228 |
Q |
| |
|
||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||| |||| ||| ||||||||| |
|
|
| T |
5832458 |
atatgtcacgctttagcctccaaaattgtagatattggacaatttggtctcttaaactaatgaaaatacgaaaacatctctaaaatat |
5832545 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University