View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6510_low_52 (Length: 212)
Name: NF6510_low_52
Description: NF6510
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6510_low_52 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 87; Significance: 7e-42; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 87; E-Value: 7e-42
Query Start/End: Original strand, 17 - 206
Target Start/End: Original strand, 3166319 - 3166507
Alignment:
| Q |
17 |
actttagcatatgcatcatcaacaaaacatgctcaatttcaacnnnnnnnncttaagctgtcgtttggatttgnnnnnnnnnnnnnnnnnnnnnagttga |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||| |
|
|
| T |
3166319 |
actttagcatatgcatcatcaacaaaacatgctcaatttcaacaaaaaaaacttaagctgtcgtttggatttgttttttctatttttcttttttagttga |
3166418 |
T |
|
| Q |
117 |
tatgtttttgggaatgacaacaaaacacaaggtctaaccattgaaataaatttacctattaaataaaacatgttttttaatcctttgctt |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||| ||||| |
|
|
| T |
3166419 |
tatgtttttgggaatgacaacaaaacacaaggtttaaccattgaaataaatttacctattaaataaaacatg-tttttaatcctatgctt |
3166507 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University