View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6512_low_11 (Length: 230)
Name: NF6512_low_11
Description: NF6512
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6512_low_11 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 15 - 216
Target Start/End: Complemental strand, 7704838 - 7704627
Alignment:
| Q |
15 |
tcaaacggaagatcttgataacaacaaactcactttaaaaacacctttcagacacaggataaaaacaacaatttagaaagctgctggtttctttctaccc |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7704838 |
tcaaacggaagatcttgataacaacaaactcactttaaaaacacctttcagacacaggataaaaacaacaatttagaaagctgctggtttctttctaccc |
7704739 |
T |
|
| Q |
115 |
aataaaaattgaaacataacataattaagggttttatc-----------gattttgatcggtatgaaacaattgctaaatggtttcttcctaattctagt |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
7704738 |
aataaaaattgaaacataacataattaagggttttatcgattggaatacgattttgatcggtatgaaacaattgctaaatgg-ttcttcctaattctagt |
7704640 |
T |
|
| Q |
204 |
acagtttcacagg |
216 |
Q |
| |
|
|||||||||||| |
|
|
| T |
7704639 |
gcagtttcacagg |
7704627 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University