View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6512_low_8 (Length: 248)
Name: NF6512_low_8
Description: NF6512
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6512_low_8 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 130; Significance: 2e-67; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 1 - 194
Target Start/End: Original strand, 30851938 - 30852132
Alignment:
| Q |
1 |
catgcattggacagacgatgtaggttgaggctcaatctgaaaccgctaccccaaacctttattgtgctttttctaagcacttggttccccaaacaaatgt |
100 |
Q |
| |
|
|||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| || ||||||||||||| |
|
|
| T |
30851938 |
catgcattggacggacgatgcaggttgaggctcaatctgaaaccgctaccccaaacctttattgtgctttttccaagcacttgttttcccaaacaaatgt |
30852037 |
T |
 |
| Q |
101 |
caaattgttagcgttgaccaa-cgatnnnnnnntccaaataaaatgattaaatactagcagcaaacctcatatgctttgctttcaaacccattaa |
194 |
Q |
| |
|
||||||||||||||||||||| | || |||||||||||||||||||||| |||| |||||||||||||||||||||||||| ||||||| |
|
|
| T |
30852038 |
caaattgttagcgttgaccaagcaataaaaaaatccaaataaaatgattaaataccagcaacaaacctcatatgctttgctttcaaatccattaa |
30852132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 193 - 234
Target Start/End: Original strand, 30852464 - 30852505
Alignment:
| Q |
193 |
aaaaacccatgtttattgaaaaccatggatctctcattcttc |
234 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
30852464 |
aaaaacccatgtttatagaaaaccatggatctctcattcttc |
30852505 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University