View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6513_high_13 (Length: 238)
Name: NF6513_high_13
Description: NF6513
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6513_high_13 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 27141481 - 27141260
Alignment:
| Q |
1 |
tactacataacttgtggtatacgaaatggcacaaataagccatcataagaatttaatattgcttctctcnnnnnnntaatttaatcttgctgatagttat |
100 |
Q |
| |
|
|||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
27141481 |
tactacattacttgtggtgtacgaaatggcacaaataagccatcataagaatttaatattgcttctctcaaaaaaataatttaatcttgctgatagttat |
27141382 |
T |
 |
| Q |
101 |
tagccaataaattttgcagcctatgtgaagaaaaagtggatgtcaactatttcaaccgttggctcagtttcatgtacaagccctgcaaaaacaaaatcct |
200 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27141381 |
tagccaataaattttgcaacctatgtgaagaaaaagtggatgtcaactatttcaaccgttggctcagtttcatgtacaagccctgcaaaaacaaaatcct |
27141282 |
T |
 |
| Q |
201 |
attagatcacaaaaattgttgg |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
27141281 |
attagatcacaaaaattgttgg |
27141260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University