View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6513_high_15 (Length: 212)

Name: NF6513_high_15
Description: NF6513
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6513_high_15
NF6513_high_15
[»] chr5 (1 HSPs)
chr5 (13-196)||(15239012-15239195)


Alignment Details
Target: chr5 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 13 - 196
Target Start/End: Complemental strand, 15239195 - 15239012
Alignment:
13 ggagcagagattcaatcttgatcatggcgtacgacgtagcatttttggtaatttatggataatgtttgagtcttttaattaacattttctatactttaaa 112  Q
    ||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
15239195 ggagccgagattcaatcttgatcatggcgtacgccgtagcatttttggtaatttatggataatgtttgagtcttttaattaacattttctatactttaaa 15239096  T
113 atataactataaacttactgaaagttaagttggcagagtagctacaagatctgcatcccatgataggctcatgcatgaaaattg 196  Q
    | || |||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||    
15239095 agattactataaacttactgaaagttaagttggcaaagcagctacaagatctgcatcccatgataggctcatgcatgaaaattg 15239012  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University