View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6513_high_8 (Length: 254)

Name: NF6513_high_8
Description: NF6513
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6513_high_8
NF6513_high_8
[»] chr3 (2 HSPs)
chr3 (18-246)||(45729121-45729349)
chr3 (22-187)||(45724991-45725156)


Alignment Details
Target: chr3 (Bit Score: 204; Significance: 1e-111; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 18 - 246
Target Start/End: Complemental strand, 45729349 - 45729121
Alignment:
18 gtttgatgtatgagattgcgaggggaatgagcatcaaggggaaaccggcggtttggaggaaggcggagagccagacacgttggccgccgtggatgaaata 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
45729349 gtttgatgtatgagattgcgaggggaatgagcatcaaggggaaaccggcggtttggaggaaggcggagagccagacacgttggccgccgtggatgaaata 45729250  T
118 gagacgcattatgaggggagcactgcaggtacctagggataatatgagacaatttactacgagaaggaatctcttcannnnnnnctctgcaacttgtttt 217  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||       ||||||||||||||||    
45729249 gagacgcattatgaggggagcactgcaggtacctagggataatatgagacaatttactacgagaaggaatctcttcatttttttctctgcaacttgtttt 45729150  T
218 ttaccatcttccatgtgtgtgttcatctc 246  Q
    |||||||||||||||||||||||| ||||    
45729149 ttaccatcttccatgtgtgtgttcttctc 45729121  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 22 - 187
Target Start/End: Complemental strand, 45725156 - 45724991
Alignment:
22 gatgtatgagattgcgaggggaatgagcatcaaggggaaaccggcggtttggaggaaggcggagagccagacacgttggccgccgtggatgaaatagaga 121  Q
    |||||||||||||| |||||||||||||||||||||||||||||| ||||  ||| ||||||||||||||||||||||||||||||||||||||||||||    
45725156 gatgtatgagattgtgaggggaatgagcatcaaggggaaaccggcagtttccaggcaggcggagagccagacacgttggccgccgtggatgaaatagaga 45725057  T
122 cgcattatgaggggagcactgcaggtacctagggataatatgagacaatttactacgagaaggaat 187  Q
    |||||||| |||||| ||| | || ||||||||| |||||| |||||||||||||  |||||||||    
45725056 cgcattattaggggaccaccggagttacctagggctaatatcagacaatttactatcagaaggaat 45724991  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University