View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6513_low_10 (Length: 254)
Name: NF6513_low_10
Description: NF6513
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6513_low_10 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 204; Significance: 1e-111; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 18 - 246
Target Start/End: Complemental strand, 45729349 - 45729121
Alignment:
| Q |
18 |
gtttgatgtatgagattgcgaggggaatgagcatcaaggggaaaccggcggtttggaggaaggcggagagccagacacgttggccgccgtggatgaaata |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45729349 |
gtttgatgtatgagattgcgaggggaatgagcatcaaggggaaaccggcggtttggaggaaggcggagagccagacacgttggccgccgtggatgaaata |
45729250 |
T |
|
| Q |
118 |
gagacgcattatgaggggagcactgcaggtacctagggataatatgagacaatttactacgagaaggaatctcttcannnnnnnctctgcaacttgtttt |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
45729249 |
gagacgcattatgaggggagcactgcaggtacctagggataatatgagacaatttactacgagaaggaatctcttcatttttttctctgcaacttgtttt |
45729150 |
T |
|
| Q |
218 |
ttaccatcttccatgtgtgtgttcatctc |
246 |
Q |
| |
|
|||||||||||||||||||||||| |||| |
|
|
| T |
45729149 |
ttaccatcttccatgtgtgtgttcttctc |
45729121 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 22 - 187
Target Start/End: Complemental strand, 45725156 - 45724991
Alignment:
| Q |
22 |
gatgtatgagattgcgaggggaatgagcatcaaggggaaaccggcggtttggaggaaggcggagagccagacacgttggccgccgtggatgaaatagaga |
121 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||| |||| ||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45725156 |
gatgtatgagattgtgaggggaatgagcatcaaggggaaaccggcagtttccaggcaggcggagagccagacacgttggccgccgtggatgaaatagaga |
45725057 |
T |
|
| Q |
122 |
cgcattatgaggggagcactgcaggtacctagggataatatgagacaatttactacgagaaggaat |
187 |
Q |
| |
|
|||||||| |||||| ||| | || ||||||||| |||||| ||||||||||||| ||||||||| |
|
|
| T |
45725056 |
cgcattattaggggaccaccggagttacctagggctaatatcagacaatttactatcagaaggaat |
45724991 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University