View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6513_low_8 (Length: 280)
Name: NF6513_low_8
Description: NF6513
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6513_low_8 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 221; Significance: 1e-121; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 18 - 270
Target Start/End: Complemental strand, 56005475 - 56005228
Alignment:
| Q |
18 |
gttgaatcaacactaacaatgatcaaattactctctctctcagatataaggacctcgaattttcttaaaaatgatgacgttgtagtcagaagttttaaac |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
56005475 |
gttgaatcaacactaacaatgatcaaattactctctctctcagatataaggacctcgaattttcttaaaaatgatgacgttgtagttagaagttttaaac |
56005376 |
T |
|
| Q |
118 |
aattttcgaactttgtcacatgtgacgcttcttcaccctataggctaagtaaatcaataaaaacaaatgcatatcaatattatataagaacagtgggaat |
217 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56005375 |
aatttttgaactttgtcacatgtgacgcttcttcaccctataggctaagtaaatcaatgaaaacaaatgcatatcaatattatataagaacagtgggaat |
56005276 |
T |
|
| Q |
218 |
caaactgaccagaacagatggaaactaaatcaaactcaatagtcctgatgatg |
270 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56005275 |
caaactgac-----cagatggaaactaaatcaaactcaatagtcctgatgatg |
56005228 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University