View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6513_low_9 (Length: 254)
Name: NF6513_low_9
Description: NF6513
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6513_low_9 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 1 - 239
Target Start/End: Original strand, 27141787 - 27142026
Alignment:
| Q |
1 |
cttattttatttgtcaatcttctaaatattataagcattttccttaaaattgtcaattgtctctattattgaatgaattgactattatcatccttttctt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||| |
|
|
| T |
27141787 |
cttattttatttgtcaatcttctaaatattataagcattttccttaaaattgtcaattgtctctattattgaatgaatcgactattatcatctttttctt |
27141886 |
T |
 |
| Q |
101 |
gtattgcaatgctcataagttcatcatttttatttcttccgtcaaaaagataataa-ttgtttatttattcattagtctcatcaacttttcttagtagaa |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
27141887 |
gtattgcaatgctcataagttcatcatttttatttcttccgtcaaaaagataataatttttttatttattcattagtctcgtcaacttttcttagtagaa |
27141986 |
T |
 |
| Q |
200 |
tggcttagtcccactctcacctctcatgtagcattcatat |
239 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
27141987 |
tggcttagtctcactctcacctctcatgtagcattcatat |
27142026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University