View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6514_low_15 (Length: 284)
Name: NF6514_low_15
Description: NF6514
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6514_low_15 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 87; Significance: 9e-42; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 87; E-Value: 9e-42
Query Start/End: Original strand, 1 - 119
Target Start/End: Original strand, 33105319 - 33105438
Alignment:
| Q |
1 |
tctcttttggagcaaatttttnnnnnnncacgtaattcaaccaaaaaat-aagtaccagtaaaatcttatgagcattaaacaatttgaagtatcaaccaa |
99 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33105319 |
tctcttttggagcaaatttttaaaaaaatacgtaattcaaccaaaaaatcaagtaccagtaaaatcttatgagcattaaacaatttgaagtatcaaccaa |
33105418 |
T |
 |
| Q |
100 |
aaacccagaaacatagatat |
119 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
33105419 |
aaacccagaaacatagatat |
33105438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 51 - 92
Target Start/End: Complemental strand, 37402829 - 37402788
Alignment:
| Q |
51 |
agtaccagtaaaatcttatgagcattaaacaatttgaagtat |
92 |
Q |
| |
|
|||||||| ||||||||||||| | ||||||||||||||||| |
|
|
| T |
37402829 |
agtaccagcaaaatcttatgagtaataaacaatttgaagtat |
37402788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University