View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6514_low_17 (Length: 267)
Name: NF6514_low_17
Description: NF6514
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6514_low_17 |
 | |
|
| [»] scaffold0470 (1 HSPs) |
| | |
|
Alignment Details
Target: chr8 (Bit Score: 90; Significance: 1e-43; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 131 - 256
Target Start/End: Original strand, 6581019 - 6581144
Alignment:
| Q |
131 |
taggtttaagtgaaagagttgaagttgtggtcccttgtgtctctttccttaaaacatctacgatgtcggttcttttatacgtctactatatatgcctcat |
230 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||| ||||||||||||||| |||| |||||| ||||||||||||| |||| ||||||||| |||| |
|
|
| T |
6581019 |
taggtttacttgaaagagttgaagttgtggtcccttgtatctctttccttaaaaaatcttcgatgtgggttcttttatacatctattatatatgcttcat |
6581118 |
T |
|
| Q |
231 |
atttctctccttatcccctcctctct |
256 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
6581119 |
atttctctccttatcccctcctctct |
6581144 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 72; E-Value: 8e-33
Query Start/End: Original strand, 19 - 136
Target Start/End: Original strand, 6580716 - 6580837
Alignment:
| Q |
19 |
gcaccaatacatcaaaagtcgatgataaccaaaatgagattctttttat--tctatttttctcacaacatggtgttaatgtttttgtcctttgtgg--tc |
114 |
Q |
| |
|
||||||||||||||||||| ||||||| ||||||||||||||||||||| |||||||||||||||||||||||| |||| |||||||||| ||| || |
|
|
| T |
6580716 |
gcaccaatacatcaaaagtagatgatagccaaaatgagattctttttattctctatttttctcacaacatggtgtcaatgcttttgtccttcctggtctc |
6580815 |
T |
|
| Q |
115 |
tgtcactcttgttttctaggtt |
136 |
Q |
| |
|
||||||||||||||| |||||| |
|
|
| T |
6580816 |
tgtcactcttgttttttaggtt |
6580837 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 208 - 256
Target Start/End: Original strand, 6612385 - 6612433
Alignment:
| Q |
208 |
tacgtctactatatatgcctcatatttctctccttatcccctcctctct |
256 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6612385 |
tacgtctactatatatgcctcatatttctctccttatcccctcctctct |
6612433 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0470 (Bit Score: 49; Significance: 4e-19; HSPs: 1)
Name: scaffold0470
Description:
Target: scaffold0470; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 208 - 256
Target Start/End: Original strand, 1673 - 1721
Alignment:
| Q |
208 |
tacgtctactatatatgcctcatatttctctccttatcccctcctctct |
256 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1673 |
tacgtctactatatatgcctcatatttctctccttatcccctcctctct |
1721 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University