View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6517_high_13 (Length: 251)
Name: NF6517_high_13
Description: NF6517
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6517_high_13 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 172; Significance: 2e-92; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 36 - 244
Target Start/End: Original strand, 16530849 - 16531048
Alignment:
| Q |
36 |
gtataagaaattagtggttgagttgagttgagttgagtaaattaataaatggggcacacaacacaatataagtgtccttgagaaagttttgaaggtgaat |
135 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16530849 |
gtataagaaattagtggttgagttgagttgagt-----aaattaataaatggggcacacaacacaatataagtgtccttgagaaagttttgaaggtgaa- |
16530942 |
T |
 |
| Q |
136 |
gaatgaatgggaaatgaacaacactaggccagcctagtcagtctcacacgcaccttcctttccttaagtatgtcagtcagacaagtcgggtttaaatata |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16530943 |
---tgaatgggaaatgaacaacactaggccagcctagtcagtctcacacgcaccttcctttccttaagtatgtcagtcagacaagtcgggtttaaatata |
16531039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University