View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6517_high_14 (Length: 246)
Name: NF6517_high_14
Description: NF6517
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6517_high_14 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 20 - 246
Target Start/End: Complemental strand, 48844519 - 48844293
Alignment:
| Q |
20 |
atgaaggccccaaaaactgtcaagtagcatttccacaactaatgcgtgaaccaaattattatttatatgacaatgnnnnnnnctatttaatttgttacag |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
48844519 |
atgaaggccccaaaaactgtcaagtagcatttccacaactaatgcgtgaaccaaattattatttatatgacaatgtttttttctatttaatttgttacag |
48844420 |
T |
 |
| Q |
120 |
ttcatatttgctactaacaatgggcatccaatgtgttgctacgaatcggtcttattcttaaatggccaccatctacacaggcagggacaaaaatgccaac |
219 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48844419 |
ttcatattttctactaacaatgggcatccaatgtgttgctacgaatcggtcttattcttaaatggccaccatctacacaggcagggacaaaaatgccaac |
48844320 |
T |
 |
| Q |
220 |
actagaaacacaattagatttggctat |
246 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
48844319 |
actagaaacacaattagatttggctat |
48844293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University