View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6517_high_18 (Length: 239)
Name: NF6517_high_18
Description: NF6517
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6517_high_18 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 18 - 239
Target Start/End: Original strand, 43138716 - 43138937
Alignment:
| Q |
18 |
ccagatttgcaaggcatctaacactgcttcatcaaccatattttcaccataaaaaacgagggagctttataggggttgatctggtgatgcagattgagac |
117 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
43138716 |
ccagatttgcaaggcatctaacgctgcttcattgaccatattttcaccataaaaaacgagggagctttatcggggttgatctggtgatgcagattgagac |
43138815 |
T |
 |
| Q |
118 |
tttagtattttaaagatcttaggttcattttctctaaaagccaataattcatgtgttgggtcggtttatagttgatacgacattttgctctaacttcagt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
43138816 |
tttagtattttaaagatcttaggttcattttctctaaaagccaataattcatgtgttgggtcggtttatagttgatacgacattttactctaacttcagt |
43138915 |
T |
 |
| Q |
218 |
tcgaatctactgatgaacaatg |
239 |
Q |
| |
|
||||||||||| ||||||||| |
|
|
| T |
43138916 |
tcgaatctactagtgaacaatg |
43138937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University