View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6517_high_6 (Length: 481)
Name: NF6517_high_6
Description: NF6517
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6517_high_6 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 430; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 430; E-Value: 0
Query Start/End: Original strand, 1 - 474
Target Start/End: Complemental strand, 30634566 - 30634093
Alignment:
| Q |
1 |
ccctatttcgatagagtcgcatacacagtacgactcgagggaatacgggtcgggcagaagctgctccaatcacccaaaacaattttcgcaccggatcata |
100 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
30634566 |
ccctatttcgatcgagtcgcatacacagtacgactcgagggaatacgggtcgggaagaagctgctccaattacccaaaacaattttcgcaccggatcata |
30634467 |
T |
 |
| Q |
101 |
ccggtgtgggtcagacaatggtggattcaggtacacagttcacgtttcttttgggaccggtttacagtgctttaagacaagaatttgtagaacaaacaaa |
200 |
Q |
| |
|
|||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30634466 |
ccggtgcgggtcagacaatggtggattcgggtacacagttcacgtttcttttgggaccggtttacagtgctttaagacaagaatttgtagaacaaacaaa |
30634367 |
T |
 |
| Q |
201 |
aggagtgttgacccttttggaagacacgaattttgtcttccaaggtgcaatggatttgtgttaccgtatcgggtcgggttcggttcttccgccgttaccg |
300 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
30634366 |
aggagtgttgacccttttggaagacacaaattttgtcttccaaggtgcaatggatttgtgttaccgtatcgggtcgggttcggttcttccaacgttaccg |
30634267 |
T |
 |
| Q |
301 |
gcggtgacacttgtgtttgaaggggcggagatgagtgtttcaggtgagagactattatataaagttgctgacgtggcattaaaagggaataataatcata |
400 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30634266 |
gcggtgacacttgtgtttgaaggggcggagatgagtgtttcaggtgagagactattatataaagttgctgacgtggcattaaaagggaataataatcata |
30634167 |
T |
 |
| Q |
401 |
gtaatgatttggtatattgtttcacatttggaaattcagatttgttgggaattgaggcatatattcttcgacat |
474 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| || ||||| |
|
|
| T |
30634166 |
gtaatgatttggtatattgtttcacgtttggaaattcagatttgttgggaattgaggcatatattattggacat |
30634093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University