View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6517_low_21 (Length: 225)
Name: NF6517_low_21
Description: NF6517
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6517_low_21 |
 | |
|
| [»] scaffold0710 (1 HSPs) |
| | |
|
Alignment Details
Target: chr1 (Bit Score: 129; Significance: 6e-67; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 129; E-Value: 6e-67
Query Start/End: Original strand, 53 - 209
Target Start/End: Complemental strand, 51804565 - 51804409
Alignment:
| Q |
53 |
ttcaattacatctgtcattccattgcttgttgtatgtcatctcttgtaagttatatcttaaattctttatgttatgctctaatagtggacttgttatatt |
152 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||| |||| |
|
|
| T |
51804565 |
ttcaattacatctgtcatatcattgcttgttgtatgtcatctctagtaagttatatcttaaattctttatgttatgctctaagagtggacttgttctatt |
51804466 |
T |
|
| Q |
153 |
catctaagcttgcttgagaaattgcctgctcgatatatttcaaagttttctgatatt |
209 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
51804465 |
catctaagcatgcttgagaaattgcctgctcgatatatttgaaagttttctgatatt |
51804409 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 96 - 209
Target Start/End: Complemental strand, 51808472 - 51808358
Alignment:
| Q |
96 |
ttgtaagttatatcttaaattctttatg-ttatgctctaatagtggacttgttatattcatctaagcttgcttgagaaattgcctgctcgatatatttca |
194 |
Q |
| |
|
||||| ||||||||||||||||||| | |||||| |||||||||||||||||||||||||||| |||| |||||||||||||||||||| |||||| | |
|
|
| T |
51808472 |
ttgtatgttatatcttaaattctttgttattatgcactaatagtggacttgttatattcatctactcttgattgagaaattgcctgctcgagatatttga |
51808373 |
T |
|
| Q |
195 |
aagttttctgatatt |
209 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
51808372 |
aagttttctgatatt |
51808358 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 165 - 209
Target Start/End: Complemental strand, 51780684 - 51780640
Alignment:
| Q |
165 |
cttgagaaattgcctgctcgatatatttcaaagttttctgatatt |
209 |
Q |
| |
|
|||| |||||||||||||||| |||||| |||||||||||||||| |
|
|
| T |
51780684 |
cttgtgaaattgcctgctcgagatatttgaaagttttctgatatt |
51780640 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 165 - 209
Target Start/End: Complemental strand, 51768201 - 51768157
Alignment:
| Q |
165 |
cttgagaaattgcctgctcgatatatttcaaagttttctgatatt |
209 |
Q |
| |
|
|||||||||| |||| ||||||||||| |||||||||||||||| |
|
|
| T |
51768201 |
cttgagaaatcgccttttcgatatatttgaaagttttctgatatt |
51768157 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0710 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: scaffold0710
Description:
Target: scaffold0710; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 161 - 209
Target Start/End: Complemental strand, 7332 - 7284
Alignment:
| Q |
161 |
cttgcttgagaaattgcctgctcgatatatttcaaagttttctgatatt |
209 |
Q |
| |
|
|||| |||||||||||||||||||| |||||| |||||||||||||||| |
|
|
| T |
7332 |
cttgattgagaaattgcctgctcgagatatttgaaagttttctgatatt |
7284 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University