View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6518_high_43 (Length: 244)
Name: NF6518_high_43
Description: NF6518
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6518_high_43 |
 |  |
|
| [»] scaffold0257 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0257 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: scaffold0257
Description:
Target: scaffold0257; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 17 - 236
Target Start/End: Complemental strand, 24699 - 24480
Alignment:
| Q |
17 |
ataccaaggtgtaaaatcggtgtttgtgtatgtcttccttaactcaagagtacacaaatgccttgctatctcatgtgctatcatttagttttatttttga |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
24699 |
ataccaaggtgtaaaatcggtgtttgtgtatgtcttccttaactcaagaatacacaaatgccttgctatctcatgtgctataatttagttttatttttga |
24600 |
T |
 |
| Q |
117 |
caccatttgtttttcctttctaaagtttatgaaactcttagttatggctttgtactataatatgatggtaattgattgaaataagactgcaagtaatatt |
216 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24599 |
caccgtttgtttttcctttctaaagtttatgaaactcttagttatggctttgtactataatatgatggtaattgattgaaataagactgcaagtaatatt |
24500 |
T |
 |
| Q |
217 |
atctagattatattcttctc |
236 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
24499 |
atctagattatattcttctc |
24480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University