View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6518_low_13 (Length: 437)
Name: NF6518_low_13
Description: NF6518
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6518_low_13 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 253; Significance: 1e-140; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 253; E-Value: 1e-140
Query Start/End: Original strand, 159 - 419
Target Start/End: Original strand, 40184205 - 40184465
Alignment:
| Q |
159 |
tgttgaccttggaggagcagaaccagcattgagactgcgatgaagaatcctagcaggagcagcatcatcagcatcagtgtcaacatcagcaatcaaatct |
258 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40184205 |
tgttgaccttggaggagcagaaccagcattgagactgcgatgaagaatcctagcaggagcagcatcatcagcatcagtgtcaacatcagcaatcaaatct |
40184304 |
T |
|
| Q |
259 |
ttcaaacccatactgacaacatcagcttcatcatcaacttcatcttcatctccaactggtgatggatagggacgcaccaaaggttttggcgcagtcctct |
358 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||| |
|
|
| T |
40184305 |
ttcaaacccatactgacaacatcagcttcatcatcaacttcatcttcatctccaactggtgatgaataaggacgcaccaaaggttttggcgcagtcctct |
40184404 |
T |
|
| Q |
359 |
gaaaataattcccataaatatactcaggcgaaaacccatgatcatcactataccccataat |
419 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40184405 |
gaaaataattcccataaatatactcaggcgaaaacccatgatcatcactataccccataat |
40184465 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University