View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6518_low_14 (Length: 437)
Name: NF6518_low_14
Description: NF6518
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6518_low_14 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 397; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 397; E-Value: 0
Query Start/End: Original strand, 19 - 427
Target Start/End: Complemental strand, 3545015 - 3544607
Alignment:
| Q |
19 |
agacttttcatcagttgagggaaaacattgacaaaacagttgaacaagtacaacagaccgatttaaggagtttctgcagtttgatggcttgaggcaaagc |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
3545015 |
agacttttcatcagttgagggaaaacattgacaaaacagttgaacaagtacaacagaacgatttaaggagtttctgcagttcgatggcttgaggcaaagc |
3544916 |
T |
|
| Q |
119 |
gattaaccaaagcgagtgtgttgctggtaacttgagcaacattgacaaccctgtccttgatggcagccttaacaattccattcatggaaggaccagcaaa |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3544915 |
gattaaccaaagcgagtgtgttgctggtaacttgagcaacattgacaaccctgtccttgatggcagccttaacaattccattcatggaaggaccagcaaa |
3544816 |
T |
|
| Q |
219 |
gccatcaagacaagtgttatcatcagtaagtgcagcactgacccaagtctgcacgttggtcatgtgccacacaaagtcctctccaacagcatgaccaata |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3544815 |
gccatcaagacaagtgttatcatcagtaagtgcagcactgacccaagtctgcacgttggtcatgtgccacacaaagtcctctccaacagcatgaccaata |
3544716 |
T |
|
| Q |
319 |
ctgcctaactccctaaccgattggctaagactgtccaaactgtcacccatgttttctatgcagtcttgtacggctctgtactcccttggcttgatgcctc |
418 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3544715 |
ctgcctaactccctaaccgattggctaagactgtccaaactgtcacccatgttttctatgcagtcttgtacggctctgtactcccttggcttgatgcctc |
3544616 |
T |
|
| Q |
419 |
ttgcctttg |
427 |
Q |
| |
|
|||| |||| |
|
|
| T |
3544615 |
ttgcttttg |
3544607 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University