View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6518_low_23 (Length: 390)
Name: NF6518_low_23
Description: NF6518
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6518_low_23 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 258; Significance: 1e-143; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 258; E-Value: 1e-143
Query Start/End: Original strand, 17 - 383
Target Start/End: Complemental strand, 10306194 - 10305825
Alignment:
| Q |
17 |
caactgctgcaccaattatcaaactaactgcaccccagaaactctttttctcaggacattgattcttcttgataaagttttcattttcaacattaacatc |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10306194 |
caactgctgcaccaattatcaaactaactgcaccccagaaactctttttctcaggacattgattcttcttgataaagttttcattttcaacattaacatc |
10306095 |
T |
|
| Q |
117 |
aatattaacattggtgtcatatttttcagg--tgatattg----cattgcatggtgcagtgaccctatttttgatatgaagaaaatttgagggtttggtt |
210 |
Q |
| |
|
|||||||||||||||||||| || || | |||||| |||| |||||| | ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10306094 |
aatattaacattggtgtcattttcagcaacattaatattggtgtcattttcaggtgcaataaccctatttttgatatgaagaaaatttgagggtttggtt |
10305995 |
T |
|
| Q |
211 |
gtgagagtagtagtagtgttgtgagtgatgaattttttggtttgaaaatggannnnnnnatggactaggatgtttggttttggatatgtgaggtttttgt |
310 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10305994 |
gtgagagtagtagt---gttgtgagtgatgaattttttggtttgaaaatggatttttttatggactaggatgtttggttttggatatgtgaggtttttgt |
10305898 |
T |
|
| Q |
311 |
ggagatgatgaagatgttgttgttgcatgttggtggaaatttttgtgtgaataggaacaagtgaatgatgatg |
383 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10305897 |
ggagatgatgaagatgttgttgttgcatgttggtggaaatttttgtgtgaataggaacaagtgaatgatgatg |
10305825 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University