View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6518_low_30 (Length: 345)
Name: NF6518_low_30
Description: NF6518
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6518_low_30 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 85; Significance: 2e-40; HSPs: 5)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 26 - 146
Target Start/End: Original strand, 5464057 - 5464177
Alignment:
| Q |
26 |
acctttgagtccaaaaacacacttgtcatgtggcaatggacaaaacatatcatcaatcaaatttgctagctttcgcacaccagtaggatcttgtgaaaat |
125 |
Q |
| |
|
|||| |||||||||||||||| |||||||||| | ||||||||| ||||||||||||||||||||||||||| |||| ||| ||||||||||||||||| |
|
|
| T |
5464057 |
acctgtgagtccaaaaacacatctgtcatgtggtattggacaaaaaatatcatcaatcaaatttgctagctttggcactccactaggatcttgtgaaaat |
5464156 |
T |
|
| Q |
126 |
taccgcgttggaagctgtcaa |
146 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
5464157 |
taccgcgttggaagctgtcaa |
5464177 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 143 - 228
Target Start/End: Original strand, 5464202 - 5464288
Alignment:
| Q |
143 |
tcaaaaggtacttttacttctttttctaggatggtttcttttttatagt-gatagggtgctatagtcaaacacaaattagacacatg |
228 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||| ||||| ||||||| ||||||||||||| |
|
|
| T |
5464202 |
tcaaaaggtatttttacttctttttctaggatggtttcttttttatagtggatagggtgttatagacaaacactaattagacacatg |
5464288 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 26 - 145
Target Start/End: Original strand, 5455393 - 5455512
Alignment:
| Q |
26 |
acctttgagtccaaaaacacacttgtcatgtggcaatggacaaaacatatcatcaatcaaatttgctagctttcgcacaccagtaggatcttgtgaaaat |
125 |
Q |
| |
|
|||| ||||||||||| |||| ||||||||||| ||||||||| ||||||||||||||||||||||||||| |||| ||||| || ||||||| ||| |
|
|
| T |
5455393 |
acctgtgagtccaaaagcacatttgtcatgtggtcctggacaaaaaatatcatcaatcaaatttgctagctttggcactccagtcgggtcttgtggaaac |
5455492 |
T |
|
| Q |
126 |
taccgcgttggaagctgtca |
145 |
Q |
| |
|
||||||| ||||||||||| |
|
|
| T |
5455493 |
taccgcgaaggaagctgtca |
5455512 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 292 - 340
Target Start/End: Original strand, 5464308 - 5464356
Alignment:
| Q |
292 |
ttccatcaatgtttccttttctctcaatacattatattgggtatgactc |
340 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
5464308 |
ttccatcaatgtttccttttttctcaatacattatattgggtatgactc |
5464356 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 163 - 228
Target Start/End: Original strand, 5455562 - 5455628
Alignment:
| Q |
163 |
tttttctaggatggtttcttttttatagt-gatagggtgctatagtcaaacacaaattagacacatg |
228 |
Q |
| |
|
|||||||||||||||||||||||||| || ||||||||||| ||| || |||| |||| |||||||| |
|
|
| T |
5455562 |
tttttctaggatggtttcttttttattgtggatagggtgctctagccagacactaatttgacacatg |
5455628 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University