View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6518_low_36 (Length: 285)
Name: NF6518_low_36
Description: NF6518
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6518_low_36 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 248; Significance: 1e-138; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 17 - 268
Target Start/End: Complemental strand, 2348597 - 2348346
Alignment:
| Q |
17 |
cagagagaaaaaaggttcttccaaactcacttattcaaagaatgatcaacattttgcagatatgttgttgaagaaattgatgaatggtaattcagataaa |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2348597 |
cagagagaaaaaaggttcttccaaactcacttattcaaagaatgatcaacattttgcagatatgttgttgaagaaattgatgaatggtaattcagataaa |
2348498 |
T |
 |
| Q |
117 |
actaatcacaaaaacagtaatgataaagtattgtggccaattggtgtgttgttaggatccaaagattaccaagtgaggagaagattgggaagggggaagg |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2348497 |
actaatcacaaaaacagtaatgataaagtattgtggccaattggtgttttgttaggatccaaagattaccaagtgaggagaagattgggaagggggaagg |
2348398 |
T |
 |
| Q |
217 |
aatttaaggaaattcaatggttaggacaaagttttgctctgaggcattttct |
268 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2348397 |
aatttaaggaaattcaatggttaggacaaagttttgctctgaggcattttct |
2348346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University